New game
Download
SCORM download
To be used in an LMS (Moodle, Blackboard...)
Regular download
To be published on a website or blog.
Downloading games is an exclusive feature for users with an Academic Plan or a Commercial Plan.
Get your Academic Plan or your Commercial Plan now and start integrating your games into your LMS, website or blog.
Get Academic Plan
If you wish, you can download a demo game here and test its integration:
Share game
Quiz
Quiz

Síntesis de Proteínas

Integrate it into your platform
G. Classroom M. Teams
You can integrate the game into an LMS compatible with LTI 1.1 or LTI 1.3 such as Canvas, Moodle, or Blackboard. This way, the scores will be automatically saved into the platform’s gradebook.
Download
You have exceeded the maximum number of games you can integrate into Google Classroom with your current Plan.

To integrate as many games as you want in Google Classroom, you need an Academic Plan or a Commercial Plan.

Get Academic Plan
You have exceeded the maximum number of games you can integrate into Microsoft Teams with your current Plan.

To integrate as many games as you want in Microsoft Teams, you need an Academic Plan or a Commercial Plan.

Get Academic Plan
Downloading games is an exclusive feature for users with an Academic Plan or a Commercial Plan.

Get your Academic Plan or your Commercial Plan now and start integrating your games into your LMS, website or blog.

If you wish, you can download a demo game here and test its integration:

Get Academic Plan

Síntesis de Proteínas

Quiz

Played 16
Create copy

About this activity

Pon a prueba tus conocimientos sobre la síntesis de proteínas con este divertido juego de preguntas.

Created by

Erika Bravo
Erika Bravo
Colombia

Download the paper version to play

Make your own free game from our game creator
Compete against your friends to see who gets the best score in this game
Make challenge

Top Games

 %
Anonymous
Anonymous
 %
%
%
You have exceeded the maximum number of games you can print with your current Plan.

To print as many games as you want, you need an Academic Plan or a Commercial Plan.

Get Academic Plan
Print your game
Síntesis de Proteínas
 

Síntesis de ProteínasOnline version

Pon a prueba tus conocimientos sobre la síntesis de proteínas con este divertido juego de preguntas.

by Erika Bravo
1

Según el dogma central de la biología molecular, el ADN puede duplicarse y después convertirse en ARN para formar estructuras más complejas llamadas proteínas, a este proceso se le conoce como

2

¿Dónde ocurre la síntesis de proteínas en la célula?

3

¿Qué molécula transporta los aminoácidos al ribosoma?

4

¿Cuál es el primer paso en la síntesis de proteínas?

5

¿Qué función tiene el ARN mensajero (ARNm)?

6

¿Qué es la traducción en la síntesis de proteínas?

7

¿Qué es un codón?

8

Qué aminoácidos codifica la siguiente cadena de ADN (TTACGGATCGGTATTATATGCCGA)

9

Los pasos de la síntesis de proteínas son

10

En la replicación del ADN se utilizan diferentes enzimas que permiten llevar a cabo cada proceso, una de ellas es la encargada de reconocer el conjunto de bases nitrogenadas donde debe empezar el proceso. Este conjunto de bases es conocido como el origen de replicación y la enzima que las reconoce es

 
Are you sure you want to leave the page?

If you leave the page, you will lose your game progress.